HomeComparativeApplication

 

.......The Search utility provides various ways for users to access predicted miRNA candidates and potential miRNA targets in detail. Under the miRNA tab, users could search for predicted miRNAs by miRNA family (e.g. miR156), plant species (e.g. Arabidopsis thaliana), mature miRNA sequence (e.g. ugacagaagagagugagcac), or miRBase AC/ID (e.g. MIMAT0000166/ath-miR156a). The Target tab allows users to search for ESTs potentially targeted by miRNA candidates through miRNA family, plant species, UniProt accession number (e.g. P93015), or GO term (e.g. rhythmic process).

Please select an option to search for potential miRNA candidates
By miRNA name e.g. miR156 or miR156a   By miRBase AC (e.g. MIMAT0000166) or ID (e.g. ath-miR156a)
 

By plant species e.g. Arabidopsis thaliana   By mature miRNA sequence e.g. ugacagaagagagugagcac
 
Number of allowed mismatches:

© Copyright 2008-2009. The Information Systems Laboratory (ISL), Bioresources Technology Unit (BTU), National Center for Genetic Engineering and Biotechnology (BIOTEC), Thailand.