.......The Search utility provides various ways for users to access predicted miRNA candidates and potential miRNA targets in detail. Under the miRNA tab, users could search for predicted miRNAs by miRNA family (e.g. miR156), plant species (e.g. Arabidopsis thaliana), mature miRNA sequence (e.g. ugacagaagagagugagcac), or miRBase AC/ID (e.g. MIMAT0000166/ath-miR156a). The Target tab allows users to search for ESTs potentially targeted by miRNA candidates through miRNA family, plant species, UniProt accession number (e.g. P93015), or GO term (e.g. rhythmic process).